Review



plko 1 neo vector control  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 neo vector control
    KEY RESOURCES TABLE
    Plko 1 Neo Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 84 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+neo+vector+control/pLKO%2E1+neo+(Plasmid+%2313425)/pmc07252493-777-19-27
    Average 94 stars, based on 84 article reviews
    plko 1 neo vector control - by Bioz Stars, 2026-10
    94/100 stars

    Images

    1) Product Images from "Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides."

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.

    Journal: Cell metabolism

    doi: 10.1016/j.cmet.2018.09.001

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Recombinant, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, In Situ, Detection Assay, shRNA, Control, Plasmid Preparation, CRISPR, Software

    Related Articles

    Recombinant:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..

    Article Title: Translational and HIF-1α-Dependent Metabolic Reprogramming Underpin Metabolic Plasticity and Responses to Kinase Inhibitors and Biguanides.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER L-asparagine Sigma-Aldrich A0884 L-asparaginase Montreal Jewish General Hospital pharmacy N/A hexadimethrine bromide (polybrene) Sigma-Aldrich 107689 puromycin, dihydrochloride Bio Basic PJ593 hygromycin B Wisent 450-141-XL G418 sulfate Bio Basic GDJ958 lipofectamine 2000 Thermo Fisher Scientific 11668027 tween-80 Sigma-Aldrich P4780 methyl cellulose Sigma-Aldrich 274429 Critical Commercial Assays Cell Proliferation Elisa BrdU (colorimetric) Roche 11647229001 Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225 Duolink In situ red mouse/rabbit kit Sigma-Aldrich DUO92101 FITC Annexin V Apoptosis Detection Kit BD Biosciences 556547 Luminescent ATP Detection Assay Kit Abcam ab113849 Deposited Data Raw and analyzed data This paper https://doi.org/10.17632/4k6knxb996.2 Experimental Models: Cell Lines A375 cells ATCC CRL-1619 NMuMG (Ursini-Siegel et al., 2008) N/A NT2197 (Ursini-Siegel et al., 2008) N/A K562 ATCC CCl-243 HCT116 (Gandin et al., 2016a) N/A RCC4 mock and RCC4-VHL (Selvarajah et al., 2013) N/A IMR90 Coriell Institute for Medical Research I90-10 WT (p53 / ) MEFs (Dowling et al., 2010) N/A Oligonucleotides qPCR primer: mCyclinD3Fw: CGAGCCTCCTACTTCCAGTG (Dowling et al., 2010) N/A qPCR primer: mCyclinD3Rv: GGACAGGTAGCGATCCAGGT (Dowling et al., 2010) N/A qPCR primer: mGAPDH Fw: TGTGTCCGTCGTGGATCTGAC This paper N/A qPCR primer: mGAPDH Rv: CACCCTGTTGCTGTAGCCGTA This paper N/A qPCR primer: mBACTIN Fw: TTCCTTCTTGGGTATGGAA This paper N/A qPCR primer: mBACTIN Rv: CCACGATCCACACAGAGTA This paper N/A qPCR primer: mASNSFw: CTGTTTGATGTTCTCCGGGC This paper N/A qPCR primer: mASNSRv: GGTAGCAGGTTGCAGTCCTC This paper N/A qPCR primer: mPHGDHfor: CTGATGCACGCCTGGGCTGG This paper N/A qPCR primer: mPHGDHrev: CCTGCTCCCCTGGAACCCCA This paper N/A A complete list of oligonucleotides used in this study is provided in Table S2. .. N/A N/A Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1a shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A (Continued on next page) e2 Cell Metabolism 28, 817–832.e1–e8, December 4, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER hCas9 (Mali et al., 2013) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-c pBabe-puro (Dowling et al., 2010) N/A pQCXIB (blast) (Campeau et al., 2009) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/

    shRNA:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..

    Article Title: Translational and HIF-1α-Dependent Metabolic Reprogramming Underpin Metabolic Plasticity and Responses to Kinase Inhibitors and Biguanides.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER L-asparagine Sigma-Aldrich A0884 L-asparaginase Montreal Jewish General Hospital pharmacy N/A hexadimethrine bromide (polybrene) Sigma-Aldrich 107689 puromycin, dihydrochloride Bio Basic PJ593 hygromycin B Wisent 450-141-XL G418 sulfate Bio Basic GDJ958 lipofectamine 2000 Thermo Fisher Scientific 11668027 tween-80 Sigma-Aldrich P4780 methyl cellulose Sigma-Aldrich 274429 Critical Commercial Assays Cell Proliferation Elisa BrdU (colorimetric) Roche 11647229001 Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225 Duolink In situ red mouse/rabbit kit Sigma-Aldrich DUO92101 FITC Annexin V Apoptosis Detection Kit BD Biosciences 556547 Luminescent ATP Detection Assay Kit Abcam ab113849 Deposited Data Raw and analyzed data This paper https://doi.org/10.17632/4k6knxb996.2 Experimental Models: Cell Lines A375 cells ATCC CRL-1619 NMuMG (Ursini-Siegel et al., 2008) N/A NT2197 (Ursini-Siegel et al., 2008) N/A K562 ATCC CCl-243 HCT116 (Gandin et al., 2016a) N/A RCC4 mock and RCC4-VHL (Selvarajah et al., 2013) N/A IMR90 Coriell Institute for Medical Research I90-10 WT (p53 / ) MEFs (Dowling et al., 2010) N/A Oligonucleotides qPCR primer: mCyclinD3Fw: CGAGCCTCCTACTTCCAGTG (Dowling et al., 2010) N/A qPCR primer: mCyclinD3Rv: GGACAGGTAGCGATCCAGGT (Dowling et al., 2010) N/A qPCR primer: mGAPDH Fw: TGTGTCCGTCGTGGATCTGAC This paper N/A qPCR primer: mGAPDH Rv: CACCCTGTTGCTGTAGCCGTA This paper N/A qPCR primer: mBACTIN Fw: TTCCTTCTTGGGTATGGAA This paper N/A qPCR primer: mBACTIN Rv: CCACGATCCACACAGAGTA This paper N/A qPCR primer: mASNSFw: CTGTTTGATGTTCTCCGGGC This paper N/A qPCR primer: mASNSRv: GGTAGCAGGTTGCAGTCCTC This paper N/A qPCR primer: mPHGDHfor: CTGATGCACGCCTGGGCTGG This paper N/A qPCR primer: mPHGDHrev: CCTGCTCCCCTGGAACCCCA This paper N/A A complete list of oligonucleotides used in this study is provided in Table S2. .. N/A N/A Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1a shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A (Continued on next page) e2 Cell Metabolism 28, 817–832.e1–e8, December 4, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER hCas9 (Mali et al., 2013) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-c pBabe-puro (Dowling et al., 2010) N/A pQCXIB (blast) (Campeau et al., 2009) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/

    Control:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..

    Article Title: Translational and HIF-1α-Dependent Metabolic Reprogramming Underpin Metabolic Plasticity and Responses to Kinase Inhibitors and Biguanides.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER L-asparagine Sigma-Aldrich A0884 L-asparaginase Montreal Jewish General Hospital pharmacy N/A hexadimethrine bromide (polybrene) Sigma-Aldrich 107689 puromycin, dihydrochloride Bio Basic PJ593 hygromycin B Wisent 450-141-XL G418 sulfate Bio Basic GDJ958 lipofectamine 2000 Thermo Fisher Scientific 11668027 tween-80 Sigma-Aldrich P4780 methyl cellulose Sigma-Aldrich 274429 Critical Commercial Assays Cell Proliferation Elisa BrdU (colorimetric) Roche 11647229001 Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225 Duolink In situ red mouse/rabbit kit Sigma-Aldrich DUO92101 FITC Annexin V Apoptosis Detection Kit BD Biosciences 556547 Luminescent ATP Detection Assay Kit Abcam ab113849 Deposited Data Raw and analyzed data This paper https://doi.org/10.17632/4k6knxb996.2 Experimental Models: Cell Lines A375 cells ATCC CRL-1619 NMuMG (Ursini-Siegel et al., 2008) N/A NT2197 (Ursini-Siegel et al., 2008) N/A K562 ATCC CCl-243 HCT116 (Gandin et al., 2016a) N/A RCC4 mock and RCC4-VHL (Selvarajah et al., 2013) N/A IMR90 Coriell Institute for Medical Research I90-10 WT (p53 / ) MEFs (Dowling et al., 2010) N/A Oligonucleotides qPCR primer: mCyclinD3Fw: CGAGCCTCCTACTTCCAGTG (Dowling et al., 2010) N/A qPCR primer: mCyclinD3Rv: GGACAGGTAGCGATCCAGGT (Dowling et al., 2010) N/A qPCR primer: mGAPDH Fw: TGTGTCCGTCGTGGATCTGAC This paper N/A qPCR primer: mGAPDH Rv: CACCCTGTTGCTGTAGCCGTA This paper N/A qPCR primer: mBACTIN Fw: TTCCTTCTTGGGTATGGAA This paper N/A qPCR primer: mBACTIN Rv: CCACGATCCACACAGAGTA This paper N/A qPCR primer: mASNSFw: CTGTTTGATGTTCTCCGGGC This paper N/A qPCR primer: mASNSRv: GGTAGCAGGTTGCAGTCCTC This paper N/A qPCR primer: mPHGDHfor: CTGATGCACGCCTGGGCTGG This paper N/A qPCR primer: mPHGDHrev: CCTGCTCCCCTGGAACCCCA This paper N/A A complete list of oligonucleotides used in this study is provided in Table S2. .. N/A N/A Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1a shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A (Continued on next page) e2 Cell Metabolism 28, 817–832.e1–e8, December 4, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER hCas9 (Mali et al., 2013) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-c pBabe-puro (Dowling et al., 2010) N/A pQCXIB (blast) (Campeau et al., 2009) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/

    Plasmid Preparation:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..

    Article Title: Translational and HIF-1α-Dependent Metabolic Reprogramming Underpin Metabolic Plasticity and Responses to Kinase Inhibitors and Biguanides.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER L-asparagine Sigma-Aldrich A0884 L-asparaginase Montreal Jewish General Hospital pharmacy N/A hexadimethrine bromide (polybrene) Sigma-Aldrich 107689 puromycin, dihydrochloride Bio Basic PJ593 hygromycin B Wisent 450-141-XL G418 sulfate Bio Basic GDJ958 lipofectamine 2000 Thermo Fisher Scientific 11668027 tween-80 Sigma-Aldrich P4780 methyl cellulose Sigma-Aldrich 274429 Critical Commercial Assays Cell Proliferation Elisa BrdU (colorimetric) Roche 11647229001 Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225 Duolink In situ red mouse/rabbit kit Sigma-Aldrich DUO92101 FITC Annexin V Apoptosis Detection Kit BD Biosciences 556547 Luminescent ATP Detection Assay Kit Abcam ab113849 Deposited Data Raw and analyzed data This paper https://doi.org/10.17632/4k6knxb996.2 Experimental Models: Cell Lines A375 cells ATCC CRL-1619 NMuMG (Ursini-Siegel et al., 2008) N/A NT2197 (Ursini-Siegel et al., 2008) N/A K562 ATCC CCl-243 HCT116 (Gandin et al., 2016a) N/A RCC4 mock and RCC4-VHL (Selvarajah et al., 2013) N/A IMR90 Coriell Institute for Medical Research I90-10 WT (p53 / ) MEFs (Dowling et al., 2010) N/A Oligonucleotides qPCR primer: mCyclinD3Fw: CGAGCCTCCTACTTCCAGTG (Dowling et al., 2010) N/A qPCR primer: mCyclinD3Rv: GGACAGGTAGCGATCCAGGT (Dowling et al., 2010) N/A qPCR primer: mGAPDH Fw: TGTGTCCGTCGTGGATCTGAC This paper N/A qPCR primer: mGAPDH Rv: CACCCTGTTGCTGTAGCCGTA This paper N/A qPCR primer: mBACTIN Fw: TTCCTTCTTGGGTATGGAA This paper N/A qPCR primer: mBACTIN Rv: CCACGATCCACACAGAGTA This paper N/A qPCR primer: mASNSFw: CTGTTTGATGTTCTCCGGGC This paper N/A qPCR primer: mASNSRv: GGTAGCAGGTTGCAGTCCTC This paper N/A qPCR primer: mPHGDHfor: CTGATGCACGCCTGGGCTGG This paper N/A qPCR primer: mPHGDHrev: CCTGCTCCCCTGGAACCCCA This paper N/A A complete list of oligonucleotides used in this study is provided in Table S2. .. N/A N/A Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1a shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A (Continued on next page) e2 Cell Metabolism 28, 817–832.e1–e8, December 4, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER hCas9 (Mali et al., 2013) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01-3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01-3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01-3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01-3-B-c pBabe-puro (Dowling et al., 2010) N/A pQCXIB (blast) (Campeau et al., 2009) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/

    CRISPR:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..

    Software:

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE ..

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.
    Article Snippet: .. Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h. ..



    Similar Products

    plko 1 neo vector control  (Addgene inc)
    94
    Addgene inc plko 1 neo vector control
    KEY RESOURCES TABLE
    Plko 1 Neo Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+neo+vector+control/pLKO%2E1+neo+(Plasmid+%2313425)/pmc07252493-777-19-27
    Average 94 stars, based on 1 article reviews
    plko 1 neo vector control - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    a plko 1 neo vector control  (Addgene inc)
    94
    Addgene inc a plko 1 neo vector control
    KEY RESOURCES TABLE
    A Plko 1 Neo Vector Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+neo+vector+control/pLKO%2E1+neo+(Plasmid+%2313425)/pmc07252493-92-0-11
    Average 94 stars, based on 1 article reviews
    a plko 1 neo vector control - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    plko.1-neo-cmv-tgfp vectors containing phb shrna or scrambled control shrna  (Millipore)
    90
    Millipore plko.1-neo-cmv-tgfp vectors containing phb shrna or scrambled control shrna
    The effect of PHB knockdown on Akt kinase activity as well as cell survival and proliferation upon UVB <t>irradiation.</t> <t>HaCaT</t> cells were stably transfected with scrambled <t>shRNA</t> (control) or PHB shRNA (PHB knockdown). (a) PHB expression in the cells was examined by western blotting analysis. The data represents three experiments. (b) Phospho-Akt in the cells treated or not treated with UVB (50 mJ/cm2, 6 h) was immunoprecipitated by immoblilized p-Akt primary antibody and incubated with GSK 3 fusion protein. Then the phosphorylation of GSK-3α/β was detected by western blotting analysis. The data represents three experiments. (c) Survival and proliferation of the cells treated or not treated with UVB (5 mJ/cm2) were assessed by clonogenic assay. The data represents the means ± SD of three independent experiments.
    Plko.1 Neo Cmv Tgfp Vectors Containing Phb Shrna Or Scrambled Control Shrna, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+neo+vector+control/plko+1+vector/pmc05479728-130-12-14
    Average 90 stars, based on 1 article reviews
    plko.1-neo-cmv-tgfp vectors containing phb shrna or scrambled control shrna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell metabolism

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.

    doi: 10.1016/j.cmet.2018.09.001

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Recombinant DNA pLKO.1 Non-Target shRNA Control Sigma-Aldrich SHC002 pLKO.1 hHIF-1α shRNA Sigma-Aldrich TRCN0000003810 pLKO.1 hIDH1 shRNA Sigma-Aldrich TRCN0000027298 a pLKO.1-neo vector control a gift from Sheila Stewart Addgene 13425 pLKO.1-neo-mIDH1 shRNA This paper N/A pLV-Hygro-U6 mPHGDH shRNA This paper N/A pLV-Hygro-U6 mASNS shRNA This paper N/A hCas9 ( Mali et al., 2013 ) Addgene 41815 CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-a CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-b CRISPR gRNA h4E-BP1 GeneCopoeia HCP204676-SG01–3-B-c CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-a CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-b CRISPR gRNA h4E-BP2 GeneCopoeia HCP254214-SG01–3-B-c CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-a CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-b CRISPR gRNA m4E-BP1 GeneCopoeia MCP227000-SG01–3-B-c CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-a CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-b CRISPR gRNA m4E-BP2 GeneCopoeia MCP229088-SG01–3-B-c pBabe-puro ( Dowling et al., 2010 ) N/A pQCXIB (blast) ( Campeau et al., 2009 ) Addgene 17487 pLV-Neo-CMV-4E-BP1 This study N/A Software and Algorithms R The R Project for Statistical Computing N/A ImageJ NCBI https://imagej.nih.gov/ij/index.html Chemstation Agilent N/A MassHunter Agilent N/A Aperio Imagescope Leica Biosystems N/A FlowJo FlowJo, LLC N/A FacsDiva BD Biosciences N/A GraphPad Prism 7.0 GraphPad Software https://www.graphpad.com/ Deposited Data Raw and analyzed data This paper https://data.mendeley.com/datasets/4k6knxb996 Open in a separate window KEY RESOURCES TABLE Puromycilation assay NT2197 cells were maintained in puromycin free media for 48h.

    Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, In Situ, Detection Assay, shRNA, Control, Plasmid Preparation, CRISPR, Software

    KEY RESOURCES TABLE

    Journal: Cell metabolism

    Article Title: Translational and HIF-1α-dependent metabolic reprogramming underpin metabolic plasticity and determine responses to kinase inhibitors and biguanides.

    doi: 10.1016/j.cmet.2018.09.001

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: a pLKO.1-neo vector control , a gift from Sheila Stewart , Addgene 13425.

    Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Bicinchoninic Acid Protein Assay, In Situ, Detection Assay, shRNA, Control, Plasmid Preparation, CRISPR, Software

    The effect of PHB knockdown on Akt kinase activity as well as cell survival and proliferation upon UVB irradiation. HaCaT cells were stably transfected with scrambled shRNA (control) or PHB shRNA (PHB knockdown). (a) PHB expression in the cells was examined by western blotting analysis. The data represents three experiments. (b) Phospho-Akt in the cells treated or not treated with UVB (50 mJ/cm2, 6 h) was immunoprecipitated by immoblilized p-Akt primary antibody and incubated with GSK 3 fusion protein. Then the phosphorylation of GSK-3α/β was detected by western blotting analysis. The data represents three experiments. (c) Survival and proliferation of the cells treated or not treated with UVB (5 mJ/cm2) were assessed by clonogenic assay. The data represents the means ± SD of three independent experiments.

    Journal: Molecular carcinogenesis

    Article Title: The role of lipid raft translocation of prohibitin in regulation of Akt and Raf-protected apoptosis of HaCaT cells upon ultraviolet B irradiation

    doi: 10.1002/mc.22636

    Figure Lengend Snippet: The effect of PHB knockdown on Akt kinase activity as well as cell survival and proliferation upon UVB irradiation. HaCaT cells were stably transfected with scrambled shRNA (control) or PHB shRNA (PHB knockdown). (a) PHB expression in the cells was examined by western blotting analysis. The data represents three experiments. (b) Phospho-Akt in the cells treated or not treated with UVB (50 mJ/cm2, 6 h) was immunoprecipitated by immoblilized p-Akt primary antibody and incubated with GSK 3 fusion protein. Then the phosphorylation of GSK-3α/β was detected by western blotting analysis. The data represents three experiments. (c) Survival and proliferation of the cells treated or not treated with UVB (5 mJ/cm2) were assessed by clonogenic assay. The data represents the means ± SD of three independent experiments.

    Article Snippet: HaCaT cells were transfected with pLKO.1-Neo-CMV-tGFP vectors containing PHB shRNA or scrambled control shRNA (Sigma, St. Louis, MO) using Lipofectamine LTX and PLUS following the manufacture’s protocol (Invitrogen, Carlsbad, CA).

    Techniques: Activity Assay, Irradiation, Stable Transfection, Transfection, shRNA, Expressing, Western Blot, Immunoprecipitation, Incubation, Clonogenic Assay

    The role of PHB in UVB-induced apoptosis in HaCaT cells. (a) HaCaT cells were transiently transfected with scrambled siRNA or PHB siRNA. The cells without transfection were used as control. The levels of PHB, p-ERK, ERK, p-Akt, Akt, and β-actin in the transfected cells with or without UVB (50 mJ/cm2, 6 h) were assessed by western blotting analysis. The data represents three experiments. (b) The levels of p-Akt, Akt, caspase-3, and β-actin in Akt I (1 μM) and/ or UVB (50 mJ/cm2, 6 h) treated cells were assessed by western blotting analysis. The data represents three experiments.

    Journal: Molecular carcinogenesis

    Article Title: The role of lipid raft translocation of prohibitin in regulation of Akt and Raf-protected apoptosis of HaCaT cells upon ultraviolet B irradiation

    doi: 10.1002/mc.22636

    Figure Lengend Snippet: The role of PHB in UVB-induced apoptosis in HaCaT cells. (a) HaCaT cells were transiently transfected with scrambled siRNA or PHB siRNA. The cells without transfection were used as control. The levels of PHB, p-ERK, ERK, p-Akt, Akt, and β-actin in the transfected cells with or without UVB (50 mJ/cm2, 6 h) were assessed by western blotting analysis. The data represents three experiments. (b) The levels of p-Akt, Akt, caspase-3, and β-actin in Akt I (1 μM) and/ or UVB (50 mJ/cm2, 6 h) treated cells were assessed by western blotting analysis. The data represents three experiments.

    Article Snippet: HaCaT cells were transfected with pLKO.1-Neo-CMV-tGFP vectors containing PHB shRNA or scrambled control shRNA (Sigma, St. Louis, MO) using Lipofectamine LTX and PLUS following the manufacture’s protocol (Invitrogen, Carlsbad, CA).

    Techniques: Transfection, Western Blot